Volume 8 issue 11 November 2007
Vps22/EAP30 in ESCRT-II mediates endosomal sorting of growth factor and chemokine receptors destined for lysosomal degradation
Lene Malerød, Susanne Stuffers, Andreas Brech and Harald Stenmark

Supplementary Materials and Methods

Alternative Vps22 siRNAs. Three separate ON-Target Plus Vps22 siRNA oligonucleotides were purchased from Dharmacon Inc. (Lafayette, CO). We have named them Vps22 siRNA #2 (sense- ggacuucuauuacgaacuauu), Vps22 siRNA #3 (sense- gcgcugaagcaacgaauguu) and Vps22 siRNA #4 (sense- aagcaggagauccggaagauu). HeLa cells were transfected with these alternative oligonucleotides as described in Materials and Methods.

Legends To Supplementary Figures

Supplemental Figure 1: Delayed EGFR degradation in response to Vps22 depletion as observed by confocal immuno-fluorescence microscopy. (HeLa cells grown on coverslips were transfected with control RNA or Vps22 siRNA. The intensities of EGFR were determined by confocal fluorescence microscopy as described in Figure 2A. B) The intensity of internalized EGFR after 15 minutes was set to 100% and the percentage EGFR remaining at each time point (relative to 15 minutes) was calculated. The result shown is the average of three separate experiments (± SD). The total numbers of cells quantified were: Control cells: 15' n= 31, 60' n= 37, 120' n= 36, 180' n= 35. Vps22 siRNA cells: 15’ n= 34, 60' n= 39, 120' n= 35, 180' n= 40.

Figure 1 (.jpg)

Supplemental Figure 2: Inhibition of EGFR degradation with alternative Vps22 siRNAs. A) HeLa cells were transfected with control RNA or Vps22 siRNAs 1-4 for 3 days, replated and grown for another 2 days. The expression of Vps22 was examined by Western blotting using an affinity purified antibody against Vps22 (upper panel). The target gene, Vps22, was efficiently depleted using the four different oligonucleotides, and nr 1 and 2 was shown to work better (approximately 75% of Vps22 was knocked down) compared to nr 3 (67% knock-down) and nr 4 (40% knock-down). Equal loading was checked by stripping the membrane and reprobing it with anti-α-tubulin (lower panel). B) Control cells or HeLa cells transfected with Vps22 siRNA 2, 3 or 4 were pretreated with 10 µg/ml cycloheximide (1 hour) and stimulated with 50 ng/ml EGF for 15, 60, 120 or 180 minutes in the presence of cycloheximide (10 µg/ml). The immunodetectable levels of EGFR (upper panel) were examined by Western blotting, and the loading was verified by anti-α-tubulin (lower panel). Degradation of EGFR (relative to α-tubulin) is delayed in Vps22 depleted cells compare to control cells C) HeLa cells grown on coverslips transfected with control RNA or the different Vps22 siRNAs were stimulated as described in B. The cells were permeabilized before fixation and stained with anti-EGFR. The EGFR intensity was measured in approximately 20 cells by confocal immunofluorescence microscopy using the same settings (below saturation) during scanning of the images. The average (± SEM) is shown.

Figure 2 (.jpg)

Supplemental Figure 3: Retransfection of Vps22 rescues EGFR degradation in Vps22 depleted cells. A) HeLa cells transfected with Vps22 siRNA duplex #1 (for 4 days) were retransfected with 300 ng HA-Vps22, 300 ng Vps25-pcDNA3.1 and 300 ng Vps36-pcDNA3.1 for 24 hours. The cells were treated with 10 µg/ml cycloheximide (1 hour) and stimulated continuously with 50 ng/ml EGF in cycloheximide-containing medium for 2 hours. The cells were permeabilized, fixed and stained with anti-HA (red) and anti-EGFR (green). B) The intensity of remaining EGFR was determined by confocal immunofluorescence scanning of all images at the same settings below saturation. By re-expressing HA-Vps22, the efficient EGFR degradation was restored and approximately 90 % of EGFR was degraded, as compared to only 10 % in Vps22 depleted cells.

Figure 3 (.jpg)